WormBase Tree Display for Variation: WBVar00275758

WBVar00275758 Evidence: Paper_evidence: WBPaper00036200
  Name: Public_name: ok5821
    Other_name: C06B8.7.1:c.5107-97G>A
    HGVSg: CHROMOSOME_V:g.15505361G>A
  Sequence_details: SMap: S_parent: Sequence: C06B8
    Flanking_sequences: CACAGGGAGAGATAGACAGACAAATAAGAG GGGAAGGGGGAGGTTGACCTACAAGTAAGC
    Mapping_target: C06B8
    Type_of_mutation: Substitution: G A
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00033306
    Laboratory: RB
    Person: WBPerson46
    Analysis: Million_Mutation_Pilot_Project
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00007372
    Transcript: C06B8.7.1 VEP_consequence: intron_variant
        VEP_impact: MODIFIER
        HGVSc: C06B8.7.1:c.5107-97G>A
        Intron_number: 15/26
  Isolation: Mutagen: EMS
  Reference: WBPaper00036200
  Remark: Allele identified through whole-genome sequencing by the Gene Knockout Consortium Paper_evidence: WBPaper00036200
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele