WormBase Tree Display for Variation: WBVar00275833

WBVar00275833 Evidence: Paper_evidence: WBPaper00036200
  Name: Public_name: ok5637
    Other_name (18)
    HGVSg: CHROMOSOME_III:g.6638815C>T
  Sequence_details: SMap: S_parent: Sequence: C13B9
    Flanking_sequences: CGAGAATCGAAACGTTGAACGGTGACGTGG ATCCGCCATGATATGAGTCAGTGATGAAGT
    Mapping_target: C13B9
    Type_of_mutation: Substitution: C T
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00033306
    Laboratory: RB
    Person: WBPerson46
    Analysis: Million_Mutation_Pilot_Project
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00015735
    Transcript (13)
  Isolation: Mutagen: EMS
  Reference: WBPaper00036200
  Remark: Allele identified through whole-genome sequencing by the Gene Knockout Consortium Paper_evidence: WBPaper00036200
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele