WormBase Tree Display for Variation: WBVar00275932

WBVar00275932 Evidence: Paper_evidence: WBPaper00036200
  Name: Public_name: ok5361
  Sequence_details: SMap: S_parent: Sequence: C28D4
    Flanking_sequences: TGTTGTGATTGTAGTAGATTTTGATTGAGGGCAAGTCAGAAACCAAGAGT TTGCGACGAAAATTGTTTCTCAGAAAATTTTTTTAAATCTTTTTTTCATT
    Mapping_target: C28D4
    Type_of_mutation: Substitution: C T
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00033305
    Laboratory: RB
    Person: WBPerson46
    Analysis: Million_Mutation_Pilot_Project
    KO_consortium_allele
    Status: Live: Curator_confirmed: WBPerson4025
  Isolation: Mutagen: ENU
  Reference: WBPaper00036200
  Remark: Allele identified through whole-genome sequencing by the Gene Knockout Consortium Paper_evidence: WBPaper00036200
    This was suppressed because it overlapped with a corrected genome sequence error feature Feature_evidence: WBsf268479
    This was un-suppressed after examination showed it is not changed by the corrected genome sequence error Curator_confirmed: WBPerson4025
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele