WormBase Tree Display for Variation: WBVar00275955

WBVar00275955 Evidence: Paper_evidence: WBPaper00036200
  Name: Public_name: gk1848
    Other_name: C32A3.1a.1:c.57-926C>T
    HGVSg: CHROMOSOME_III:g.3619457G>A
  Sequence_details: SMap: S_parent: Sequence: C32A3
    Flanking_sequences: AAATCTAGCTTTCAGCAAATTGAATTTTCA CAAGTTCATCAAGGATCCATCAAGGTGTTC
    Mapping_target: C32A3
    Type_of_mutation: Substitution: G A
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00036970
    Laboratory: VC
    Person: WBPerson427
    Analysis: Million_Mutation_Pilot_Project
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00004765
    Transcript: C32A3.1a.1 VEP_consequence: intron_variant
        VEP_impact: MODIFIER
        HGVSc: C32A3.1a.1:c.57-926C>T
        Intron_number: 2/7
  Isolation: Mutagen: EMS
  Reference: WBPaper00036200
  Remark: Allele identified through whole-genome sequencing by the Gene Knockout Consortium Paper_evidence: WBPaper00036200
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele