WormBase Tree Display for Variation: WBVar00275996
expand all nodes | collapse all nodes | view schema
WBVar00275996 | Evidence | Paper_evidence | WBPaper00036200 | ||
---|---|---|---|---|---|
Name | Public_name | ok5918 | |||
Other_name | C35B8.3b.1:c.19C>T | ||||
CE02536:p.His7Tyr | |||||
C35B8.3a.2:c.-27C>T | |||||
HGVSg | CHROMOSOME_X:g.9214000C>T | ||||
Sequence_details | SMap | S_parent | Sequence | C35B8 | |
Flanking_sequences | ATAAACTCAAACATGCACCAAAACCCTGCG | ACGTCTTATCAATTCTCTCATGGTCTGTTT | |||
Mapping_target | C35B8 | ||||
Type_of_mutation | Substitution | C | T | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00033306 | ||||
Laboratory | RB | ||||
Person | WBPerson46 | ||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00016438 | |||
Transcript | C35B8.3a.2 | VEP_consequence | 5_prime_UTR_variant | ||
VEP_impact | MODIFIER | ||||
HGVSc | C35B8.3a.2:c.-27C>T | ||||
cDNA_position | 78 | ||||
Exon_number | 1/11 | ||||
C35B8.3b.1 (11) | |||||
Isolation | Mutagen | EMS | |||
Reference | WBPaper00036200 | ||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |