WormBase Tree Display for Variation: WBVar00276007
expand all nodes | collapse all nodes | view schema
WBVar00276007 | Evidence | Paper_evidence | WBPaper00036200 | ||
---|---|---|---|---|---|
Name | Public_name | ok5483 | |||
Other_name | CE39537:p.Phe387Val | ||||
CE31271:p.Phe392Val | |||||
ZK54.1a.1:c.1174T>G | |||||
ZK54.1b.1:c.1159T>G | |||||
HGVSg | CHROMOSOME_X:g.17461238A>C | ||||
Sequence_details | SMap | S_parent | Sequence | ZK54 | |
Flanking_sequences | GTGGGGCCAAATCCAGATGATTTACTGAAA | TCCACACCAACAAATTCCGCCTAGTCCGAT | |||
Mapping_target | ZK54 | ||||
Type_of_mutation | Substitution | A | C | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00033305 | ||||
Laboratory | RB | ||||
Person | WBPerson46 | ||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00022647 | |||
Transcript | ZK54.1a.1 (12) | ||||
ZK54.1b.1 (12) | |||||
Isolation | Mutagen | ENU | |||
Reference | WBPaper00036200 | ||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |