WormBase Tree Display for Variation: WBVar00276041

WBVar00276041 Evidence: Paper_evidence: WBPaper00036200
  Name: Public_name: gk925
    Other_name: C41G7.2.1:c.442C>T
      CE08666:p.Pro148Ser
    HGVSg: CHROMOSOME_I:g.9513097C>T
  Sequence_details: SMap: S_parent: Sequence: C41G7
    Flanking_sequences: GCCCGACCAGTGGCACAGAAGCCTATTCTC CTTCCAAAGTGACGCTTCTTGAGGAGAGAA
    Mapping_target: C41G7
    Type_of_mutation: Substitution: C T
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00036970
    Laboratory: VC
    Person: WBPerson427
    Analysis: Million_Mutation_Pilot_Project
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00002226
    Transcript: C41G7.2.1 VEP_consequence: missense_variant
        VEP_impact: MODERATE
        HGVSc: C41G7.2.1:c.442C>T
        HGVSp: CE08666:p.Pro148Ser
        cDNA_position: 516
        CDS_position: 442
        Protein_position: 148
        Exon_number: 3/6
        Codon_change: Cct/Tct
        Amino_acid_change: P/S
  Isolation: Mutagen: EMS
  Reference: WBPaper00036200
  Remark: Allele identified through whole-genome sequencing by the Gene Knockout Consortium Paper_evidence: WBPaper00036200
    Allele confirmed by Sanger sequencing
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele