WormBase Tree Display for Variation: WBVar00276116

WBVar00276116 Evidence: Paper_evidence: WBPaper00036200
  Name: Public_name: ok5306
    Other_name: C50C3.9c.1:c.1039-241T>G
      C50C3.9a.1:c.1170+23T>G
    HGVSg: CHROMOSOME_III:g.8198069A>C
  Sequence_details: SMap: S_parent: Sequence: C50C3
    Flanking_sequences: CAAATCACAAACGATACAATGCAACAAAGA AGCGTTTACATGCAAAGCTTACAGAATCAA
    Mapping_target: C50C3
    Type_of_mutation: Substitution: A C
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00033305
    Laboratory: RB
    Person: WBPerson46
    Analysis: Million_Mutation_Pilot_Project
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00006772
    Transcript: C50C3.9a.1 VEP_consequence: intron_variant
        VEP_impact: MODIFIER
        HGVSc: C50C3.9a.1:c.1170+23T>G
        Intron_number: 8/17
      C50C3.9c.1 VEP_consequence: intron_variant
        VEP_impact: MODIFIER
        HGVSc: C50C3.9c.1:c.1039-241T>G
        Intron_number: 7/16
  Isolation: Mutagen: ENU
  Reference: WBPaper00036200
  Remark: Allele identified through whole-genome sequencing by the Gene Knockout Consortium Paper_evidence: WBPaper00036200
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele