WormBase Tree Display for Variation: WBVar00276139

WBVar00276139 Evidence: Paper_evidence: WBPaper00036200
  Name: Public_name: ok5705
    Other_name (22)
    HGVSg: CHROMOSOME_IV:g.8981091C>T
  Sequence_details: SMap: S_parent: Sequence: C53B4
    Flanking_sequences: GAAACGAAAGAACACCGATGCTTCAGATCT AATGGGGAAAGCATCGAAATTGGAGCAGAT
    Mapping_target: C53B4
    Type_of_mutation: Substitution: C T
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00033306
    Laboratory: RB
    Person: WBPerson46
    Analysis: Million_Mutation_Pilot_Project
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00008274
    Transcript (11)
  Isolation: Mutagen: EMS
  Reference: WBPaper00036200
  Remark: Allele identified through whole-genome sequencing by the Gene Knockout Consortium Paper_evidence: WBPaper00036200
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele