WormBase Tree Display for Variation: WBVar00276179
expand all nodes | collapse all nodes | view schema
WBVar00276179 | Evidence | Paper_evidence | WBPaper00036200 | ||
---|---|---|---|---|---|
Name | Public_name | gk2292 | |||
Other_name | D1007.15b.1:c.1099+48A>G | ||||
D1007.15c.1:c.1121-24A>G | |||||
D1007.15a.1:c.1120+48A>G | |||||
HGVSg | CHROMOSOME_I:g.4559741A>G | ||||
Sequence_details | SMap | S_parent | Sequence | D1007 | |
Flanking_sequences | GGCAAACTAGAGAAATAGTAAATAATTTTT | GTATTAGATAGGGTATTTTTCAGGTTACAC | |||
Mapping_target | D1007 | ||||
Type_of_mutation | Substitution | A | G | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00037339 | ||||
Laboratory | VC | ||||
Person | WBPerson427 | ||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00017010 | |||
Transcript | D1007.15b.1 | VEP_consequence | intron_variant | ||
VEP_impact | MODIFIER | ||||
HGVSc | D1007.15b.1:c.1099+48A>G | ||||
Intron_number | 7/17 | ||||
D1007.15c.1 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | D1007.15c.1:c.1121-24A>G | ||||
Intron_number | 6/6 | ||||
D1007.15a.1 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | D1007.15a.1:c.1120+48A>G | ||||
Intron_number | 7/17 | ||||
Isolation | Mutagen | ENU | |||
Reference | WBPaper00036200 | ||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |