WormBase Tree Display for Variation: WBVar00276233
expand all nodes | collapse all nodes | view schema
WBVar00276233 | Evidence | Paper_evidence | WBPaper00036200 | ||
---|---|---|---|---|---|
Name | Public_name | ok5192 | |||
Other_name | CE04334:p.Leu759= | ||||
F01G12.5a.1:c.2277G>A | |||||
CE04335:p.Leu760= | |||||
F01G12.5b.1:c.2280G>A | |||||
HGVSg | CHROMOSOME_X:g.16384537C>T | ||||
Sequence_details | SMap | S_parent | Sequence | F01G12 | |
Flanking_sequences | TGGGAGGCCAGAGTCTCCCTTCATTCCTGG | AGTCCTGGGAATCCTGGTTGACCGACTTCT | |||
Mapping_target | F01G12 | ||||
Type_of_mutation | Substitution | C | T | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00033304 | ||||
Laboratory | RB | ||||
Person | WBPerson46 | ||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00002280 | |||
Transcript | F01G12.5b.1 | VEP_consequence | synonymous_variant | ||
VEP_impact | LOW | ||||
HGVSc | F01G12.5b.1:c.2280G>A | ||||
HGVSp | CE04335:p.Leu760= | ||||
cDNA_position | 2280 | ||||
CDS_position | 2280 | ||||
Protein_position | 760 | ||||
Exon_number | 13/18 | ||||
Codon_change | ctG/ctA | ||||
Amino_acid_change | L | ||||
F01G12.5a.1 | VEP_consequence | synonymous_variant | |||
VEP_impact | LOW | ||||
HGVSc | F01G12.5a.1:c.2277G>A | ||||
HGVSp | CE04334:p.Leu759= | ||||
cDNA_position | 2290 | ||||
CDS_position | 2277 | ||||
Protein_position | 759 | ||||
Exon_number | 14/20 | ||||
Codon_change | ctG/ctA | ||||
Amino_acid_change | L | ||||
Isolation | Mutagen | EMS | |||
Reference | WBPaper00036200 | ||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |