WormBase Tree Display for Variation: WBVar00276262

WBVar00276262 Evidence: Paper_evidence: WBPaper00036200
  Name: Public_name: ok5180
    Other_name: F08G12.8.1:c.-59G>A
    HGVSg: CHROMOSOME_X:g.11317303G>A
  Sequence_details: SMap: S_parent: Sequence: F08G12
    Flanking_sequences: GCCTATATATATTATTCACTTTTCGATTTA AAAATTCATTTTACTTCTCTCGTTCTCAAT
    Mapping_target: F08G12
    Type_of_mutation: Substitution: G A
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00033304
    Laboratory: RB
    Person: WBPerson46
    Analysis: Million_Mutation_Pilot_Project
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00008589
    Transcript: F08G12.8.1 VEP_consequence: 5_prime_UTR_variant
        VEP_impact: MODIFIER
        HGVSc: F08G12.8.1:c.-59G>A
        cDNA_position: 254
        Exon_number: 1/5
  Isolation: Mutagen: EMS
  Reference: WBPaper00036200
  Remark: Allele identified through whole-genome sequencing by the Gene Knockout Consortium Paper_evidence: WBPaper00036200
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele