WormBase Tree Display for Variation: WBVar00276266
expand all nodes | collapse all nodes | view schema
WBVar00276266 | Evidence | Paper_evidence | WBPaper00036200 | ||
---|---|---|---|---|---|
Name | Public_name | ok5470 | |||
Other_name | F09A5.3b.1:c.-82+3173C>T | ||||
HGVSg | CHROMOSOME_X:g.13144900C>T | ||||
Sequence_details | SMap | S_parent | Sequence | F09A5 | |
Flanking_sequences | TATCCAAAAAGTATAACCGATAGGTTTCTG | CGAGTCCCATTAAGTTCCAAATCTAGACAT | |||
Mapping_target | F09A5 | ||||
Type_of_mutation | Substitution | C | T | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00033305 | ||||
Laboratory | RB | ||||
Person | WBPerson46 | ||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00303113 | |||
WBGene00008600 | |||||
WBGene00003283 | |||||
Transcript | F09A5.3b.1 | VEP_consequence | intron_variant | ||
VEP_impact | MODIFIER | ||||
HGVSc | F09A5.3b.1:c.-82+3173C>T | ||||
Intron_number | 1/7 | ||||
F09A5.15 | |||||
F09A5.6 | |||||
Isolation | Mutagen | ENU | |||
Reference | WBPaper00036200 | ||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |