WormBase Tree Display for Variation: WBVar00276286
expand all nodes | collapse all nodes | view schema
| WBVar00276286 | Evidence | Paper_evidence | WBPaper00036200 | ||
|---|---|---|---|---|---|
| Name | Public_name | ok5794 | |||
| Other_name | F10C2.10:n.182G>A | ||||
| F57F5.5c.1:c.147-233C>T | |||||
| F57F5.5a.3:c.-22-233C>T | |||||
| F57F5.5a.2:c.-22-233C>T | |||||
| HGVSg | CHROMOSOME_V:g.12024393G>A | ||||
| Sequence_details | SMap | S_parent | Sequence | F10C2 | |
| Flanking_sequences | GACGCGACGAAGGCAGAGGGGAAATGGGCG | AGCGCGGCCTGGAAACGGGTGTGACAGCAG | |||
| Mapping_target | F10C2 | ||||
| Type_of_mutation | Substitution | G | A | ||
| SeqStatus | Sequenced | ||||
| Variation_type | Allele | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain | WBStrain00033306 | ||||
| Laboratory | RB | ||||
| Person | WBPerson46 | ||||
| Analysis | Million_Mutation_Pilot_Project | ||||
| KO_consortium_allele | |||||
| Status | Live | ||||
| Affects | Gene | WBGene00196303 | |||
| WBGene00004032 | |||||
| Transcript | F57F5.5a.2 | VEP_consequence | intron_variant | ||
| VEP_impact | MODIFIER | ||||
| HGVSc | F57F5.5a.2:c.-22-233C>T | ||||
| Intron_number | 2/15 | ||||
| F57F5.5c.1 | VEP_consequence | intron_variant | |||
| VEP_impact | MODIFIER | ||||
| HGVSc | F57F5.5c.1:c.147-233C>T | ||||
| Intron_number | 2/13 | ||||
| F10C2.10 | VEP_consequence | non_coding_transcript_exon_variant | |||
| VEP_impact | MODIFIER | ||||
| HGVSc | F10C2.10:n.182G>A | ||||
| cDNA_position | 182 | ||||
| Exon_number | 1/1 | ||||
| F57F5.5a.3 | VEP_consequence | intron_variant | |||
| VEP_impact | MODIFIER | ||||
| HGVSc | F57F5.5a.3:c.-22-233C>T | ||||
| Intron_number | 1/14 | ||||
| Isolation | Mutagen | EMS | |||
| Reference | WBPaper00036200 | ||||
| Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
| Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
| Method | KO_consortium_allele |
