WormBase Tree Display for Variation: WBVar00276288
expand all nodes | collapse all nodes | view schema
| WBVar00276288 | Evidence | Paper_evidence | WBPaper00036200 | ||
|---|---|---|---|---|---|
| Name | Public_name | gk1614 | |||
| Other_name | F10D7.3.1:c.40-203G>A | ||||
| HGVSg | CHROMOSOME_X:g.17374277C>T | ||||
| Sequence_details | SMap | S_parent | Sequence | F10D7 | |
| Flanking_sequences | GTTCATCGTAGGCCTATAATTCCTGATGAG | CTGATGTACTAGGAAGCTTAAGTTTGTAGT | |||
| Mapping_target | F10D7 | ||||
| Type_of_mutation | Substitution | C | T | ||
| SeqStatus | Sequenced | ||||
| Variation_type | Allele | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain | WBStrain00036969 | ||||
| Laboratory | VC | ||||
| Person | WBPerson427 | ||||
| Analysis | Million_Mutation_Pilot_Project | ||||
| KO_consortium_allele | |||||
| Status | Live | ||||
| Affects | Gene | WBGene00017340 | |||
| Transcript | F10D7.3.1 | VEP_consequence | intron_variant | ||
| VEP_impact | MODIFIER | ||||
| HGVSc | F10D7.3.1:c.40-203G>A | ||||
| Intron_number | 2/6 | ||||
| Isolation | Mutagen | EMS | |||
| Reference | WBPaper00036200 | ||||
| Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
| Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
| Method | KO_consortium_allele |
