WormBase Tree Display for Variation: WBVar00276302
expand all nodes | collapse all nodes | view schema
WBVar00276302 | Evidence | Paper_evidence | WBPaper00036200 | ||
---|---|---|---|---|---|
Name | Public_name | gk2925 | |||
Other_name | F11F1.1b.1:c.1322-324C>T | ||||
F11F1.9.1:c.44C>T | |||||
F11F1.1a.1:c.1322-926C>T | |||||
CE15803:p.Ala15Val | |||||
HGVSg | CHROMOSOME_III:g.13398942C>T | ||||
Sequence_details | SMap | S_parent | Sequence | F11F1 | |
Flanking_sequences | AAGTTGCTTTCACACTTGTTGTTTCAATTG | AATTGTAACAGCAGTTCCTCTCGGAGGGAT | |||
Mapping_target | F11F1 | ||||
Type_of_mutation | Substitution | C | T | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00005866 | ||||
Laboratory | VC | ||||
Person | WBPerson427 | ||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00008714 | |||
WBGene00306134 | |||||
Transcript | F11F1.1a.1 | VEP_consequence | intron_variant | ||
VEP_impact | MODIFIER | ||||
HGVSc | F11F1.1a.1:c.1322-926C>T | ||||
Intron_number | 6/8 | ||||
F11F1.9.1 (12) | |||||
F11F1.1b.1 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | F11F1.1b.1:c.1322-324C>T | ||||
Intron_number | 5/8 | ||||
Isolation | Mutagen | EMS | |||
Reference | WBPaper00036200 | ||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |