WormBase Tree Display for Variation: WBVar00276344

WBVar00276344 Evidence: Paper_evidence: WBPaper00036200
  Name: Public_name: gk2112
    Other_name: CE32383:p.Cys604=
      F16B12.6.1:c.1812C>T
    HGVSg: CHROMOSOME_X:g.14104667C>T
  Sequence_details: SMap: S_parent: Sequence: F16B12
    Flanking_sequences: CGTAGAGACAATGTCGACACTTGCCAGATG AAAAGAGTGAGAAAGAGGGTAAGTTAACCA
    Mapping_target: F16B12
    Type_of_mutation: Substitution: C T
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00036970
    Laboratory: VC
    Person: WBPerson427
    Analysis: Million_Mutation_Pilot_Project
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00008882
    Transcript: F16B12.6.1 VEP_consequence: synonymous_variant
        VEP_impact: LOW
        HGVSc: F16B12.6.1:c.1812C>T
        HGVSp: CE32383:p.Cys604=
        cDNA_position: 1855
        CDS_position: 1812
        Protein_position: 604
        Exon_number: 9/18
        Codon_change: tgC/tgT
        Amino_acid_change: C
  Isolation: Mutagen: EMS
  Reference: WBPaper00036200
  Remark: Allele identified through whole-genome sequencing by the Gene Knockout Consortium Paper_evidence: WBPaper00036200
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele