WormBase Tree Display for Variation: WBVar00276344
expand all nodes | collapse all nodes | view schema
WBVar00276344 | Evidence | Paper_evidence | WBPaper00036200 | ||
---|---|---|---|---|---|
Name | Public_name | gk2112 | |||
Other_name | CE32383:p.Cys604= | ||||
F16B12.6.1:c.1812C>T | |||||
HGVSg | CHROMOSOME_X:g.14104667C>T | ||||
Sequence_details | SMap | S_parent | Sequence | F16B12 | |
Flanking_sequences | CGTAGAGACAATGTCGACACTTGCCAGATG | AAAAGAGTGAGAAAGAGGGTAAGTTAACCA | |||
Mapping_target | F16B12 | ||||
Type_of_mutation | Substitution | C | T | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00036970 | ||||
Laboratory | VC | ||||
Person | WBPerson427 | ||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00008882 | |||
Transcript | F16B12.6.1 | VEP_consequence | synonymous_variant | ||
VEP_impact | LOW | ||||
HGVSc | F16B12.6.1:c.1812C>T | ||||
HGVSp | CE32383:p.Cys604= | ||||
cDNA_position | 1855 | ||||
CDS_position | 1812 | ||||
Protein_position | 604 | ||||
Exon_number | 9/18 | ||||
Codon_change | tgC/tgT | ||||
Amino_acid_change | C | ||||
Isolation | Mutagen | EMS | |||
Reference | WBPaper00036200 | ||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |