WormBase Tree Display for Variation: WBVar00276391
expand all nodes | collapse all nodes | view schema
WBVar00276391 | Evidence | Paper_evidence | WBPaper00036200 | ||
---|---|---|---|---|---|
Name | Public_name | ok5387 | |||
Other_name | F22F7.4c.1:c.857C>T | ||||
CE50963:p.Thr367Ile | |||||
F22F7.4a.1:c.1100C>T | |||||
CE51013:p.Thr286Ile | |||||
HGVSg | CHROMOSOME_V:g.2104321G>A | ||||
Sequence_details | SMap | S_parent | Sequence | F22F7 | |
Flanking_sequences | CTCCAATGAATCCTGTGCTCCTGGTCTTGA | TGAGATATATTGCGTGATTATCCGAATTCC | |||
Mapping_target | F22F7 | ||||
Type_of_mutation | Substitution | G | A | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00033305 | ||||
Laboratory | RB | ||||
Person | WBPerson46 | ||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00017722 | |||
Transcript | F22F7.4c.1 (12) | ||||
F22F7.4a.1 (12) | |||||
Isolation | Mutagen | ENU | |||
Reference | WBPaper00036200 | ||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |