WormBase Tree Display for Variation: WBVar00276429

WBVar00276429 Evidence: Paper_evidence: WBPaper00036200
  Name: Public_name: gk2863
    Other_name (23)
    HGVSg: CHROMOSOME_II:g.14406563A>G
  Sequence_details: SMap: S_parent: Sequence: F26H11
    Flanking_sequences: ATCGCCACCAACGTTTCTCGTCGTCGCCGA CTTCTGCGAATCTCTCAAAATCTGAAGATG
    Mapping_target: F26H11
    Type_of_mutation: Substitution: A G
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00005866
    Laboratory: VC
    Person: WBPerson427
    Analysis: Million_Mutation_Pilot_Project
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00009180
    Transcript (12)
  Isolation: Mutagen: EMS
  Reference: WBPaper00036200
  Remark: Allele identified through whole-genome sequencing by the Gene Knockout Consortium Paper_evidence: WBPaper00036200
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele