WormBase Tree Display for Variation: WBVar00276461

WBVar00276461 Evidence: Paper_evidence: WBPaper00036200
  Name: Public_name: ok5074
    Other_name: F32A11.5:n.744T>C
    HGVSg: CHROMOSOME_II:g.13131860T>C
  Sequence_details: SMap: S_parent: Sequence: F32A11
    Flanking_sequences: TCGGCGTGCATATGATGTTGCTGGATCCTG AAAGGAGTTGCCGTGTCCCTCAATGGCAAA
    Mapping_target: F32A11
    Type_of_mutation: Substitution: T C
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00033304
    Laboratory: RB
    Person: WBPerson46
    Analysis: Million_Mutation_Pilot_Project
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00009310
    Pseudogene: F32A11.5 VEP_consequence: non_coding_transcript_exon_variant
        VEP_impact: MODIFIER
        HGVSc: F32A11.5:n.744T>C
        cDNA_position: 744
        Exon_number: 3/8
  Isolation: Mutagen: EMS
  Reference: WBPaper00036200
  Remark: Allele identified through whole-genome sequencing by the Gene Knockout Consortium Paper_evidence: WBPaper00036200
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele