WormBase Tree Display for Variation: WBVar00276497

WBVar00276497 Evidence: Paper_evidence: WBPaper00036200
  Name: Public_name: ok5154
    Other_name: F35H12.1.1:c.955+146G>A
    HGVSg: CHROMOSOME_X:g.936854G>A
  Sequence_details: SMap: S_parent: Sequence: F35H12
    Flanking_sequences: ATCTATTCGAAATCTTCTGTAGGAACTTTG GAGGTTTAGTAGATTTCATAGACGAATATT
    Mapping_target: F35H12
    Type_of_mutation: Substitution: G A
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00033304
    Laboratory: RB
    Person: WBPerson46
    Analysis: Million_Mutation_Pilot_Project
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00018074
    Transcript: F35H12.1.1 VEP_consequence: intron_variant
        VEP_impact: MODIFIER
        HGVSc: F35H12.1.1:c.955+146G>A
        Intron_number: 8/12
  Isolation: Mutagen: EMS
  Reference: WBPaper00036200
  Remark: Allele identified through whole-genome sequencing by the Gene Knockout Consortium Paper_evidence: WBPaper00036200
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele