WormBase Tree Display for Variation: WBVar00276567

WBVar00276567 Evidence: Paper_evidence: WBPaper00036200
  Name: Public_name: ok5660
    Other_name: F43D9.2.1:c.554+301G>T
    HGVSg: CHROMOSOME_III:g.10501951C>A
  Sequence_details: SMap: S_parent: Sequence: F43D9
    Flanking_sequences: CTAAAAGTTTCGATTTTTGAAGAAAAAAAA ACTTTTTTCATAAATATTTCAATTATCCAA
    Mapping_target: F43D9
    Type_of_mutation: Substitution: C A
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00033306
    Laboratory: RB
    Person: WBPerson46
    Analysis: Million_Mutation_Pilot_Project
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00004283
    Transcript: F43D9.2.1 VEP_consequence: intron_variant
        VEP_impact: MODIFIER
        HGVSc: F43D9.2.1:c.554+301G>T
        Intron_number: 4/6
  Isolation: Mutagen: EMS
  Reference: WBPaper00036200
  Remark: Allele identified through whole-genome sequencing by the Gene Knockout Consortium Paper_evidence: WBPaper00036200
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele