WormBase Tree Display for Variation: WBVar00276588
expand all nodes | collapse all nodes | view schema
| WBVar00276588 | Evidence | Paper_evidence | WBPaper00036200 | ||
|---|---|---|---|---|---|
| Name | Public_name | ok5285 | |||
| Other_name | F45H7.2a.1:c.697-71A>G | ||||
| F45H7.2d.1:c.190-71A>G | |||||
| F45H7.2b.1:c.697-71A>G | |||||
| F45H7.2d.3:c.190-71A>G | |||||
| F45H7.2d.2:c.190-71A>G | |||||
| HGVSg | CHROMOSOME_III:g.3346945A>G | ||||
| Sequence_details | SMap | S_parent | Sequence | F45H7 | |
| Flanking_sequences | CTTAGGCTTAGGCTTAGGCTTAGGCTTAGGCTTACCCATGACGTAGGCTT | GGCCAATGCCTCTAATTTTTACACCAGGAAATGGGGTAACTTGCGATTCA | |||
| Mapping_target | F45H7 | ||||
| Type_of_mutation | Substitution | A | G | ||
| SeqStatus | Sequenced | ||||
| Variation_type | Allele | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain | WBStrain00033305 | ||||
| Laboratory | RB | ||||
| Person | WBPerson46 | ||||
| Analysis | Million_Mutation_Pilot_Project | ||||
| KO_consortium_allele | |||||
| Status | Live | Curator_confirmed | WBPerson4025 | ||
| Affects | Gene | WBGene00001559 | |||
| Transcript | F45H7.2d.3 | VEP_consequence | intron_variant | ||
| VEP_impact | MODIFIER | ||||
| HGVSc | F45H7.2d.3:c.190-71A>G | ||||
| Intron_number | 3/23 | ||||
| F45H7.2a.1 | VEP_consequence | intron_variant | |||
| VEP_impact | MODIFIER | ||||
| HGVSc | F45H7.2a.1:c.697-71A>G | ||||
| Intron_number | 7/27 | ||||
| F45H7.2d.1 | VEP_consequence | intron_variant | |||
| VEP_impact | MODIFIER | ||||
| HGVSc | F45H7.2d.1:c.190-71A>G | ||||
| Intron_number | 6/25 | ||||
| F45H7.2b.1 | VEP_consequence | intron_variant | |||
| VEP_impact | MODIFIER | ||||
| HGVSc | F45H7.2b.1:c.697-71A>G | ||||
| Intron_number | 7/25 | ||||
| F45H7.2d.2 | VEP_consequence | intron_variant | |||
| VEP_impact | MODIFIER | ||||
| HGVSc | F45H7.2d.2:c.190-71A>G | ||||
| Intron_number | 4/23 | ||||
| Isolation | Mutagen | ENU | |||
| Reference | WBPaper00036200 | ||||
| Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
| This was suppressed because it overlapped with a corrected genome sequence error feature | Feature_evidence | WBsf268561 | |||
| This was un-suppressed after examination showed it is not changed by the corrected genome sequence error | Curator_confirmed | WBPerson4025 | |||
| Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
| Method | KO_consortium_allele |
