WormBase Tree Display for Variation: WBVar00276740

WBVar00276740 Evidence: Paper_evidence: WBPaper00036200
  Name: Public_name: ok5094
    Other_name: F56C9.3.2:c.678G>A
      CE29406:p.Val226=
      F56C9.3.1:c.678G>A
    HGVSg: CHROMOSOME_III:g.7312111G>A
  Sequence_details: SMap: S_parent: Sequence: F56C9
    Flanking_sequences: GGCAAGTGTACAGCTTATTATCTCCTCAGT AGAAGAATCCATGACGCAGGTGCGAATCTT
    Mapping_target: F56C9
    Type_of_mutation: Substitution: G A
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00033304
    Laboratory: RB
    Person: WBPerson46
    Analysis: Million_Mutation_Pilot_Project
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00018948
    Transcript: F56C9.3.2 VEP_consequence: synonymous_variant
        VEP_impact: LOW
        HGVSc: F56C9.3.2:c.678G>A
        HGVSp: CE29406:p.Val226=
        cDNA_position: 709
        CDS_position: 678
        Protein_position: 226
        Exon_number: 4/8
        Codon_change: gtG/gtA
        Amino_acid_change: V
      F56C9.3.1 VEP_consequence: synonymous_variant
        VEP_impact: LOW
        HGVSc: F56C9.3.1:c.678G>A
        HGVSp: CE29406:p.Val226=
        cDNA_position: 716
        CDS_position: 678
        Protein_position: 226
        Exon_number: 4/8
        Codon_change: gtG/gtA
        Amino_acid_change: V
  Isolation: Mutagen: EMS
  Reference: WBPaper00036200
  Remark: Allele identified through whole-genome sequencing by the Gene Knockout Consortium Paper_evidence: WBPaper00036200
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele