WormBase Tree Display for Variation: WBVar00276763
expand all nodes | collapse all nodes | view schema
WBVar00276763 | Evidence | Paper_evidence | WBPaper00036200 | ||
---|---|---|---|---|---|
Name | Public_name | ok5775 | |||
Other_name | CE46895:p.Gln230His | ||||
CE49946:p.Gln174His | |||||
F58E6.13c.1:c.690A>T | |||||
F58E6.13d.1:c.522A>T | |||||
HGVSg | CHROMOSOME_V:g.9748200A>T | ||||
Sequence_details | SMap | S_parent | Sequence | F58E6 | |
Flanking_sequences | AGTAGGTACAGGCACACAGAAAAAGGAACA | TGTGTTCGTATGTTTCCATATATTTTATAT | |||
Mapping_target | F58E6 | ||||
Type_of_mutation | Substitution | A | T | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00033306 | ||||
Laboratory | RB | ||||
Person | WBPerson46 | ||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00077697 | |||
Transcript | F58E6.13d.1 (12) | ||||
F58E6.13c.1 (12) | |||||
Isolation | Mutagen | EMS | |||
Reference | WBPaper00036200 | ||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |