WormBase Tree Display for Variation: WBVar00276789
expand all nodes | collapse all nodes | view schema
WBVar00276789 | Evidence | Paper_evidence | WBPaper00036200 | ||
---|---|---|---|---|---|
Name | Public_name | ok5559 | |||
Other_name | F59H6.8.1:c.*16+3296A>G | ||||
F59H6.2:n.2119+8T>C | |||||
HGVSg | CHROMOSOME_II:g.2022330T>C | ||||
Sequence_details | SMap | S_parent | Sequence | F59H6 | |
Flanking_sequences | ATCGAAGCTCTTGGAATTGCGATGTAGGAA | TTGTAATACCACTAAAACTCTTGATTGATT | |||
Mapping_target | F59H6 | ||||
Type_of_mutation | Substitution | T | C | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00033306 | ||||
Laboratory | RB | ||||
Person | WBPerson46 | ||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00019133 | |||
WBGene00019138 | |||||
Transcript | F59H6.8.1 | VEP_consequence | intron_variant | ||
VEP_impact | MODIFIER | ||||
HGVSc | F59H6.8.1:c.*16+3296A>G | ||||
Intron_number | 6/6 | ||||
Pseudogene | F59H6.2 | VEP_consequence | splice_region_variant,intron_variant,non_coding_transcript_variant | ||
VEP_impact | LOW | ||||
HGVSc | F59H6.2:n.2119+8T>C | ||||
Intron_number | 13/14 | ||||
Isolation | Mutagen | EMS | |||
Reference | WBPaper00036200 | ||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |