WormBase Tree Display for Variation: WBVar00276798
expand all nodes | collapse all nodes | view schema
WBVar00276798 | Evidence | Paper_evidence | WBPaper00036200 | ||
---|---|---|---|---|---|
Name | Public_name | ok5371 | |||
Other_name | H08M01.2d.1:c.259-109T>C | ||||
H08M01.2b.1:c.3610-109T>C | |||||
H08M01.2c.1:c.1186-109T>C | |||||
HGVSg | CHROMOSOME_IV:g.13843066T>C | ||||
Sequence_details | SMap | S_parent | Sequence | H08M01 | |
Flanking_sequences | ATTTCAATTTTGTAACTGACGACCTGGCAA | GAATACTCTTTATTTCAATATATTGAAACA | |||
Mapping_target | H08M01 | ||||
Type_of_mutation | Substitution | T | C | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00033305 | ||||
Laboratory | RB | ||||
Person | WBPerson46 | ||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00010374 | |||
Transcript | H08M01.2c.1 | VEP_consequence | intron_variant | ||
VEP_impact | MODIFIER | ||||
HGVSc | H08M01.2c.1:c.1186-109T>C | ||||
Intron_number | 9/11 | ||||
H08M01.2d.1 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | H08M01.2d.1:c.259-109T>C | ||||
Intron_number | 3/5 | ||||
H08M01.2b.1 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | H08M01.2b.1:c.3610-109T>C | ||||
Intron_number | 19/22 | ||||
Isolation | Mutagen | ENU | |||
Reference | WBPaper00036200 | ||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |