WormBase Tree Display for Variation: WBVar00276908
expand all nodes | collapse all nodes | view schema
WBVar00276908 | Evidence | Paper_evidence | WBPaper00036200 | ||
---|---|---|---|---|---|
Name | Public_name | ok5638 | |||
Other_name | CE54069:p.Pro6274Leu | ||||
K07E12.1.1:c.18821C>T | |||||
HGVSg | CHROMOSOME_III:g.6770996C>T | ||||
Sequence_details | SMap | S_parent | Sequence | R05H11 | |
Flanking_sequences | CTGACAGCAATGGAAACTTCATTATTGTAC | CTCTGAAAAAAGAATGGATGAAGAACTTCC | |||
Mapping_target | R05H11 | ||||
Type_of_mutation | Substitution | C | T | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00033306 | ||||
Laboratory | RB | ||||
Person | WBPerson46 | ||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00305511 | |||
WBGene00000998 | |||||
Transcript | K07E12.10 | ||||
K07E12.1.1 | VEP_consequence | missense_variant | |||
VEP_impact | MODERATE | ||||
HGVSc | K07E12.1.1:c.18821C>T | ||||
HGVSp | CE54069:p.Pro6274Leu | ||||
cDNA_position | 18945 | ||||
CDS_position | 18821 | ||||
Protein_position | 6274 | ||||
Exon_number | 33/50 | ||||
Codon_change | cCc/cTc | ||||
Amino_acid_change | P/L | ||||
Isolation | Mutagen | EMS | |||
Reference | WBPaper00036200 | ||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |