WormBase Tree Display for Variation: WBVar00276967

WBVar00276967 Evidence: Paper_evidence: WBPaper00036200
  Name: Public_name: gk2632
    Other_name: K12D9.5.1:c.126A>G
      CE34345:p.Ser42=
    HGVSg: CHROMOSOME_V:g.2996031T>C
  Sequence_details: SMap: S_parent: Sequence: K12D9
    Flanking_sequences: TATCAAAACACTTGAAATTGAAATTTCAGA GAATAGCTTAGAATTTTTTGAGCGAATGGT
    Mapping_target: K12D9
    Type_of_mutation: Substitution: T C
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00037340
    Laboratory: VC
    Person: WBPerson427
    Analysis: Million_Mutation_Pilot_Project
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00005867
    Transcript: K12D9.5.1 VEP_consequence: synonymous_variant
        VEP_impact: LOW
        HGVSc: K12D9.5.1:c.126A>G
        HGVSp: CE34345:p.Ser42=
        cDNA_position: 126
        CDS_position: 126
        Protein_position: 42
        Exon_number: 2/5
        Codon_change: tcA/tcG
        Amino_acid_change: S
  Isolation: Mutagen: ENU
  Reference: WBPaper00036200
  Remark: Allele identified through whole-genome sequencing by the Gene Knockout Consortium Paper_evidence: WBPaper00036200
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele