WormBase Tree Display for Variation: WBVar00276976

WBVar00276976 Evidence: Paper_evidence: WBPaper00036200
  Name: Public_name: gk2776
    Other_name: CE12292:p.Phe86=
      M01E11.3.1:c.258C>T
    HGVSg: CHROMOSOME_I:g.5573500C>T
  Sequence_details: SMap: S_parent: Sequence: M01E11
    Flanking_sequences: AAAAGTTGTCATTGTTAAAAGAATGATTTT CAGGTTATTAGTTTGAAGATCTGCCGAAAA
    Mapping_target: M01E11
    Type_of_mutation: Substitution: C T
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00005866
    Laboratory: VC
    Person: WBPerson427
    Analysis: Million_Mutation_Pilot_Project
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00019712
    Transcript: M01E11.3.1 VEP_consequence: synonymous_variant
        VEP_impact: LOW
        HGVSc: M01E11.3.1:c.258C>T
        HGVSp: CE12292:p.Phe86=
        cDNA_position: 287
        CDS_position: 258
        Protein_position: 86
        Exon_number: 2/13
        Codon_change: ttC/ttT
        Amino_acid_change: F
  Isolation: Mutagen: EMS
  Reference: WBPaper00036200
  Remark: Allele identified through whole-genome sequencing by the Gene Knockout Consortium Paper_evidence: WBPaper00036200
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele