WormBase Tree Display for Variation: WBVar00276997

WBVar00276997 Evidence: Paper_evidence: WBPaper00036200
  Name: Public_name: ok5100
    Other_name: M03C11.2.1:c.1393-9C>T
      M03C11.2.2:c.1393-9C>T
    HGVSg: CHROMOSOME_III:g.10401439G>A
  Sequence_details: SMap: S_parent: Sequence: M03C11
    Flanking_sequences: TCTCATTTTCTTTCTTGATTTCCTGGAAAA TTATTGGATTCTAGGTTTTAGGCTTCGGAA
    Mapping_target: M03C11
    Type_of_mutation: Substitution: G A
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00033304
    Laboratory: RB
    Person: WBPerson46
    Analysis: Million_Mutation_Pilot_Project
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00010839
    Transcript: M03C11.2.1 VEP_consequence: intron_variant
        VEP_impact: MODIFIER
        HGVSc: M03C11.2.1:c.1393-9C>T
        Intron_number: 6/10
      M03C11.2.2 VEP_consequence: intron_variant
        VEP_impact: MODIFIER
        HGVSc: M03C11.2.2:c.1393-9C>T
        Intron_number: 6/10
  Isolation: Mutagen: EMS
  Reference: WBPaper00036200
  Remark: Allele identified through whole-genome sequencing by the Gene Knockout Consortium Paper_evidence: WBPaper00036200
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele