WormBase Tree Display for Variation: WBVar00277007

WBVar00277007 Evidence: Paper_evidence: WBPaper00036200
  Name: Public_name: ok5046
    Other_name: CE28628:p.Pro66=
      M151.7.1:c.198A>C
    HGVSg: CHROMOSOME_II:g.3622534A>C
  Sequence_details: SMap: S_parent: Sequence: M151
    Flanking_sequences: TTATGGTCCCGAGGGGCTGCTCCAAGGACC CCACCGTTGAGCCAGGACCAACTGAACTCG
    Mapping_target: M151
    Type_of_mutation: Substitution: A C
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00033304
    Laboratory: RB
    Person: WBPerson46
    Analysis: Million_Mutation_Pilot_Project
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00019799
    Transcript: M151.7.1 VEP_consequence: synonymous_variant
        VEP_impact: LOW
        HGVSc: M151.7.1:c.198A>C
        HGVSp: CE28628:p.Pro66=
        cDNA_position: 221
        CDS_position: 198
        Protein_position: 66
        Exon_number: 2/9
        Codon_change: ccA/ccC
        Amino_acid_change: P
  Isolation: Mutagen: EMS
  Reference: WBPaper00036200
  Remark: Allele identified through whole-genome sequencing by the Gene Knockout Consortium Paper_evidence: WBPaper00036200
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele