WormBase Tree Display for Variation: WBVar00277077
expand all nodes | collapse all nodes | view schema
WBVar00277077 | Evidence | Paper_evidence | WBPaper00036200 | ||
---|---|---|---|---|---|
Name | Public_name | gk1831 | |||
Other_name | R06B10.4b.1:c.1420-35A>G | ||||
R06B10.4a.1:c.1420-35A>G | |||||
HGVSg | CHROMOSOME_III:g.997357A>G | ||||
Sequence_details | SMap | S_parent | Sequence | R06B10 | |
Flanking_sequences | AAAAATGTTTAATTTTCTCAGATGTCACAA | AATACTTCAAAATCAAATAAATTACCATTT | |||
Mapping_target | R06B10 | ||||
Type_of_mutation | Substitution | A | G | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00036970 | ||||
Laboratory | VC | ||||
Person | WBPerson427 | ||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00006615 | |||
Transcript | R06B10.4a.1 | VEP_consequence | intron_variant | ||
VEP_impact | MODIFIER | ||||
HGVSc | R06B10.4a.1:c.1420-35A>G | ||||
Intron_number | 9/18 | ||||
R06B10.4b.1 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | R06B10.4b.1:c.1420-35A>G | ||||
Intron_number | 9/19 | ||||
Isolation | Mutagen | EMS | |||
Reference | WBPaper00036200 | ||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |