WormBase Tree Display for Variation: WBVar00277085
expand all nodes | collapse all nodes | view schema
WBVar00277085 | Evidence | Paper_evidence | WBPaper00036200 | ||
---|---|---|---|---|---|
Name | Public_name | gk2512 | |||
Other_name | CE40770:p.Val242= | ||||
R07C3.15.1:c.726A>G | |||||
HGVSg | CHROMOSOME_II:g.918412A>G | ||||
Sequence_details | SMap | S_parent | Sequence | R07C3 | |
Flanking_sequences | TCAAAAACTGTCTATCAAGCCACAAGGAGT | CTTCGGTTACCGAAAACTTTAAAGTTCAAA | |||
Mapping_target | R07C3 | ||||
Type_of_mutation | Substitution | A | G | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00037340 | ||||
Laboratory | VC | ||||
Person | WBPerson427 | ||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00045302 | |||
WBGene00305555 | |||||
Transcript | R07C3.18 | ||||
R07C3.15.1 | VEP_consequence | synonymous_variant | |||
VEP_impact | LOW | ||||
HGVSc | R07C3.15.1:c.726A>G | ||||
HGVSp | CE40770:p.Val242= | ||||
cDNA_position | 726 | ||||
CDS_position | 726 | ||||
Protein_position | 242 | ||||
Exon_number | 2/4 | ||||
Codon_change | gtA/gtG | ||||
Amino_acid_change | V | ||||
Isolation | Mutagen | ENU | |||
Reference | WBPaper00036200 | ||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |