WormBase Tree Display for Variation: WBVar00277094

WBVar00277094 Evidence: Paper_evidence: WBPaper00036200
  Name: Public_name: ok5882
    Other_name: R08E3.3b.1:c.1278+98C>T
    HGVSg: CHROMOSOME_X:g.4820825C>T
  Sequence_details: SMap: S_parent: Sequence: R08E3
    Flanking_sequences: TGGAAAAAAATAAAATAAAATAAAATAAAA TTTCAGAAGAATTTTCAGTATCTATTTATG
    Mapping_target: R08E3
    Type_of_mutation: Substitution: C T
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00033306
    Laboratory: RB
    Person: WBPerson46
    Analysis: Million_Mutation_Pilot_Project
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00019959
    Transcript: R08E3.3b.1 VEP_consequence: intron_variant
        VEP_impact: MODIFIER
        HGVSc: R08E3.3b.1:c.1278+98C>T
        Intron_number: 11/13
  Isolation: Mutagen: EMS
  Reference: WBPaper00036200
  Remark: Allele identified through whole-genome sequencing by the Gene Knockout Consortium Paper_evidence: WBPaper00036200
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele