WormBase Tree Display for Variation: WBVar00277098

WBVar00277098 Evidence: Paper_evidence: WBPaper00036200
  Name: Public_name: ok5941
    Other_name: R09A8.4:n.416G>A
    HGVSg: CHROMOSOME_X:g.12636591C>T
  Sequence_details: SMap: S_parent: Sequence: R09A8
    Flanking_sequences: ATATCCCTGGATATAGTTGTTCCCGGTGGT CTGGTGGGCAGACGCGGCATCCGTCCTTTG
    Mapping_target: R09A8
    Type_of_mutation: Substitution: C T
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00033306
    Laboratory: RB
    Person: WBPerson46
    Analysis: Million_Mutation_Pilot_Project
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00000755
    Pseudogene: R09A8.4 VEP_consequence: non_coding_transcript_exon_variant
        VEP_impact: MODIFIER
        HGVSc: R09A8.4:n.416G>A
        cDNA_position: 416
        Exon_number: 2/2
  Isolation: Mutagen: EMS
  Reference: WBPaper00036200
  Remark: Allele identified through whole-genome sequencing by the Gene Knockout Consortium Paper_evidence: WBPaper00036200
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele