WormBase Tree Display for Variation: WBVar00277134
expand all nodes | collapse all nodes | view schema
WBVar00277134 | Evidence | Paper_evidence | WBPaper00036200 | ||
---|---|---|---|---|---|
Name | Public_name | gk2532 | |||
Other_name | R153.8:n.129C>A | ||||
R153.3:n.53G>T | |||||
HGVSg | CHROMOSOME_II:g.7625273G>T | ||||
Sequence_details | SMap | S_parent | Sequence | R153 | |
Flanking_sequences | GAGAGTTGACGAAATAAGTGTTAGCGGAGAGTTTTGGAAGGCGAAGTGGG | TGGCTCTGCGGCCATTAGACGAAACGCTGAAGAAAGGAGGAAATGCTCCG | |||
Mapping_target | R153 | ||||
Type_of_mutation | Substitution | G | T | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00037340 | ||||
Laboratory | VC | ||||
Person | WBPerson427 | ||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00196288 | |||
WBGene00201675 | |||||
Transcript | R153.3 | VEP_consequence | non_coding_transcript_exon_variant | ||
VEP_impact | MODIFIER | ||||
HGVSc | R153.3:n.53G>T | ||||
cDNA_position | 53 | ||||
Exon_number | 1/1 | ||||
R153.8 | VEP_consequence | non_coding_transcript_exon_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | R153.8:n.129C>A | ||||
cDNA_position | 129 | ||||
Exon_number | 1/1 | ||||
Isolation | Mutagen | ENU | |||
Reference | WBPaper00036200 | ||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |