WormBase Tree Display for Variation: WBVar00277224

WBVar00277224 Evidence: Paper_evidence: WBPaper00036200
  Name: Public_name: ok5743
    Other_name: CE17230:p.Ile75=
      T08H10.1.1:c.225C>T
    HGVSg: CHROMOSOME_V:g.4484204C>T
  Sequence_details: SMap: S_parent: Sequence: T08H10
    Flanking_sequences: CTCATCTGGAAAACTGAAACGCGAGGACAT TTCGTCACCTCTAAACTTCCATTTACCGCT
    Mapping_target: T08H10
    Type_of_mutation: Substitution: C T
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00033306
    Laboratory: RB
    Person: WBPerson46
    Analysis: Million_Mutation_Pilot_Project
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00020369
    Transcript: T08H10.1.1 VEP_consequence: synonymous_variant
        VEP_impact: LOW
        HGVSc: T08H10.1.1:c.225C>T
        HGVSp: CE17230:p.Ile75=
        cDNA_position: 271
        CDS_position: 225
        Protein_position: 75
        Exon_number: 3/6
        Codon_change: atC/atT
        Amino_acid_change: I
  Isolation: Mutagen: EMS
  Reference: WBPaper00036200
  Remark: Allele identified through whole-genome sequencing by the Gene Knockout Consortium Paper_evidence: WBPaper00036200
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele