WormBase Tree Display for Variation: WBVar00277231

WBVar00277231 Evidence: Paper_evidence: WBPaper00036200
  Name: Public_name: ok5385
    Other_name: CE18237:p.Lys92Ter
      T10B5.7a.1:c.274A>T
    HGVSg: CHROMOSOME_V:g.1846700A>T
  Sequence_details: SMap: S_parent: Sequence: T10B5
    Flanking_sequences: TCCGGTTTGACACTGGTGTCGCATGATGAT AGGCAATTATCATTGCGTTCAGGTGAGAGG
    Mapping_target: T10B5
    Type_of_mutation: Substitution: A T
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00033305
    Laboratory: RB
    Person: WBPerson46
    Analysis: Million_Mutation_Pilot_Project
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00020393
    Transcript: T10B5.7a.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: T10B5.7a.1:c.274A>T
        HGVSp: CE18237:p.Lys92Ter
        cDNA_position: 306
        CDS_position: 274
        Protein_position: 92
        Exon_number: 4/8
        Codon_change: Aag/Tag
        Amino_acid_change: K/*
  Isolation: Mutagen: ENU
  Reference: WBPaper00036200
  Remark: Allele identified through whole-genome sequencing by the Gene Knockout Consortium Paper_evidence: WBPaper00036200
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele