WormBase Tree Display for Variation: WBVar00277268
expand all nodes | collapse all nodes | view schema
WBVar00277268 | Evidence | Paper_evidence | WBPaper00036200 | ||
---|---|---|---|---|---|
Name | Public_name | ok5448 | |||
Other_name | T14E8.4.1:c.416+87T>C | ||||
T14E8.1b.2:c.*176-2285A>G | |||||
HGVSg | CHROMOSOME_X:g.6561730A>G | ||||
Sequence_details | SMap | S_parent | Sequence | T14E8 | |
Flanking_sequences | ATAGAGACTGAAGTACTACTGGAGTCTACG | TACTAATTTTTAGAAGGCCTTGAAGGGTGC | |||
Mapping_target | T14E8 | ||||
Type_of_mutation | Substitution | A | G | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00033305 | ||||
Laboratory | RB | ||||
Person | WBPerson46 | ||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00043981 | |||
WBGene00020504 | |||||
Transcript | T14E8.1b.2 | VEP_consequence | intron_variant | ||
VEP_impact | MODIFIER | ||||
HGVSc | T14E8.1b.2:c.*176-2285A>G | ||||
Intron_number | 20/20 | ||||
T14E8.4.1 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | T14E8.4.1:c.416+87T>C | ||||
Intron_number | 5/10 | ||||
Isolation | Mutagen | ENU | |||
Reference | WBPaper00036200 | ||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |