WormBase Tree Display for Variation: WBVar00277275

WBVar00277275 Evidence: Paper_evidence: WBPaper00036200
  Name: Public_name: ok5804
    Other_name: CE20078:p.Trp83Ter
      T16G1.8.1:c.249G>A
    HGVSg: CHROMOSOME_V:g.12945598G>A
  Sequence_details: SMap: S_parent: Sequence: T16G1
    Flanking_sequences: TAACTCCATAATTAATTTTCAGTCGGGTTG TCGAATCCCATCCCTTCATATGCTTCTGCT
    Mapping_target: T16G1
    Type_of_mutation: Substitution: G A
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00033306
    Laboratory: RB
    Person: WBPerson46
    Analysis: Million_Mutation_Pilot_Project
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00001711
    Transcript: T16G1.8.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: T16G1.8.1:c.249G>A
        HGVSp: CE20078:p.Trp83Ter
        cDNA_position: 352
        CDS_position: 249
        Protein_position: 83
        Exon_number: 3/8
        Codon_change: tgG/tgA
        Amino_acid_change: W/*
  Isolation: Mutagen: EMS
  Reference: WBPaper00036200
  Remark: Allele identified through whole-genome sequencing by the Gene Knockout Consortium Paper_evidence: WBPaper00036200
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele