WormBase Tree Display for Variation: WBVar00277287
expand all nodes | collapse all nodes | view schema
WBVar00277287 | Evidence | Paper_evidence | WBPaper00036200 | ||
---|---|---|---|---|---|
Name | Public_name | ok5170 | |||
Other_name | ZK899.8k.1:c.524-86G>A | ||||
ZK899.8i.2:c.-680-86G>A | |||||
ZK899.8i.3:c.-680-86G>A | |||||
ZK899.8a.1:c.524-86G>A | |||||
ZK899.8c.1:c.620-86G>A | |||||
ZK899.8e.1:c.47-86G>A | |||||
ZK899.8b.1:c.353-86G>A | |||||
ZK899.8d.1:c.254-86G>A | |||||
ZK899.8h.1:c.107-86G>A | |||||
HGVSg | CHROMOSOME_X:g.9496455G>A | ||||
Sequence_details | SMap | S_parent | Sequence | T19C11 | |
Flanking_sequences | AAACCGGCACTGGTAGACAACAGTGCACAG | GGCCAAAAAGGTTAAACTTGATGTAGATAT | |||
Mapping_target | T19C11 | ||||
Type_of_mutation | Substitution | G | A | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00033304 | ||||
Laboratory | RB | ||||
Person | WBPerson46 | ||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00001516 | |||
Transcript | ZK899.8a.1 | VEP_consequence | intron_variant | ||
VEP_impact | MODIFIER | ||||
HGVSc | ZK899.8a.1:c.524-86G>A | ||||
Intron_number | 4/19 | ||||
ZK899.8h.1 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | ZK899.8h.1:c.107-86G>A | ||||
Intron_number | 2/18 | ||||
ZK899.8i.2 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | ZK899.8i.2:c.-680-86G>A | ||||
Intron_number | 1/18 | ||||
ZK899.8e.1 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | ZK899.8e.1:c.47-86G>A | ||||
Intron_number | 2/16 | ||||
ZK899.8c.1 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | ZK899.8c.1:c.620-86G>A | ||||
Intron_number | 2/17 | ||||
ZK899.8b.1 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | ZK899.8b.1:c.353-86G>A | ||||
Intron_number | 3/19 | ||||
ZK899.8i.3 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | ZK899.8i.3:c.-680-86G>A | ||||
Intron_number | 1/18 | ||||
ZK899.8k.1 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | ZK899.8k.1:c.524-86G>A | ||||
Intron_number | 4/19 | ||||
ZK899.8d.1 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | ZK899.8d.1:c.254-86G>A | ||||
Intron_number | 1/16 | ||||
Isolation | Mutagen | EMS | |||
Reference | WBPaper00036200 | ||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |