WormBase Tree Display for Variation: WBVar00277326
expand all nodes | collapse all nodes | view schema
WBVar00277326 | Evidence | Paper_evidence | WBPaper00036200 | ||
---|---|---|---|---|---|
Name | Public_name | ok5942 | |||
Other_name | CE16442:p.Ser316Phe | ||||
F16H9.2b.1:c.34+16547G>A | |||||
F16H9.2a.1:c.-24+16547G>A | |||||
T22H6.4.1:c.947C>T | |||||
HGVSg | CHROMOSOME_X:g.12791669C>T | ||||
Sequence_details | SMap | S_parent | Sequence | T22H6 | |
Flanking_sequences | TTCGATATTTTGTCTTTTGCCGTTCAGAAT | TTCGTATGTATCATCTGCACTTTCATTAAC | |||
Mapping_target | T22H6 | ||||
Type_of_mutation | Substitution | C | T | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00033306 | ||||
Laboratory | RB | ||||
Person | WBPerson46 | ||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00008901 | |||
WBGene00006174 | |||||
Transcript | T22H6.4.1 | VEP_consequence | missense_variant | ||
VEP_impact | MODERATE | ||||
HGVSc | T22H6.4.1:c.947C>T | ||||
HGVSp | CE16442:p.Ser316Phe | ||||
cDNA_position | 947 | ||||
CDS_position | 947 | ||||
Protein_position | 316 | ||||
Exon_number | 6/6 | ||||
Codon_change | tCt/tTt | ||||
Amino_acid_change | S/F | ||||
F16H9.2b.1 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | F16H9.2b.1:c.34+16547G>A | ||||
Intron_number | 1/3 | ||||
F16H9.2a.1 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | F16H9.2a.1:c.-24+16547G>A | ||||
Intron_number | 1/4 | ||||
Isolation | Mutagen | EMS | |||
Reference | WBPaper00036200 | ||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |