WormBase Tree Display for Variation: WBVar00277391
expand all nodes | collapse all nodes | view schema
WBVar00277391 | Evidence | Paper_evidence | WBPaper00036200 | ||
---|---|---|---|---|---|
Name | Public_name | ok5683 | |||
Other_name | CE30698:p.Ser172Leu | ||||
T28H11.7.1:c.-861G>A | |||||
T28H11.1.1:c.515C>T | |||||
HGVSg | CHROMOSOME_IV:g.5017069C>T | ||||
Sequence_details | SMap | S_parent | Sequence | T28H11 | |
Flanking_sequences | CTGTCGGTGGAGCCCCAATGGGAGGAGGAT | AACAATGACTGCCGTTGGAGGAGCGCCATC | |||
Mapping_target | T28H11 | ||||
Type_of_mutation | Substitution | C | T | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00033306 | ||||
Laboratory | RB | ||||
Person | WBPerson46 | ||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00006053 | |||
WBGene00020905 | |||||
Transcript | T28H11.1.1 | VEP_consequence | missense_variant | ||
VEP_impact | MODERATE | ||||
HGVSc | T28H11.1.1:c.515C>T | ||||
HGVSp | CE30698:p.Ser172Leu | ||||
cDNA_position | 545 | ||||
CDS_position | 515 | ||||
Protein_position | 172 | ||||
Exon_number | 3/5 | ||||
Codon_change | tCa/tTa | ||||
Amino_acid_change | S/L | ||||
T28H11.7.1 | VEP_consequence | 5_prime_UTR_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | T28H11.7.1:c.-861G>A | ||||
cDNA_position | 107 | ||||
Exon_number | 1/6 | ||||
Isolation | Mutagen | EMS | |||
Reference | WBPaper00036200 | ||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |