WormBase Tree Display for Variation: WBVar00277392
expand all nodes | collapse all nodes | view schema
| WBVar00277392 | Evidence | Paper_evidence | WBPaper00036200 | ||
|---|---|---|---|---|---|
| Name | Public_name | ok5347 | |||
| Other_name | T28H11.8.1:c.-12A>C | ||||
| HGVSg | CHROMOSOME_IV:g.5020617T>G | ||||
| Sequence_details | SMap | S_parent | Sequence | C09B9 | |
| Flanking_sequences | AAAATCGAAAATTGTTCATTTTCAACTGGA | TTTTGTTCATTCGAATCTGTAAATCAAGTT | |||
| Mapping_target | C09B9 | ||||
| Type_of_mutation | Substitution | T | G | ||
| SeqStatus | Sequenced | ||||
| Variation_type | Allele | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain | WBStrain00033305 | ||||
| Laboratory | RB | ||||
| Person | WBPerson46 | ||||
| Analysis | Million_Mutation_Pilot_Project | ||||
| KO_consortium_allele | |||||
| Status | Live | ||||
| Affects | Gene | WBGene00020906 | |||
| Transcript | T28H11.8.1 | VEP_consequence | 5_prime_UTR_variant | ||
| VEP_impact | MODIFIER | ||||
| HGVSc | T28H11.8.1:c.-12A>C | ||||
| cDNA_position | 17 | ||||
| Exon_number | 1/9 | ||||
| Isolation | Mutagen | ENU | |||
| Reference | WBPaper00036200 | ||||
| Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
| Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
| Method | KO_consortium_allele |
