WormBase Tree Display for Variation: WBVar00277392
expand all nodes | collapse all nodes | view schema
WBVar00277392 | Evidence | Paper_evidence | WBPaper00036200 | ||
---|---|---|---|---|---|
Name | Public_name | ok5347 | |||
Other_name | T28H11.8.1:c.-12A>C | ||||
HGVSg | CHROMOSOME_IV:g.5020617T>G | ||||
Sequence_details | SMap | S_parent | Sequence | C09B9 | |
Flanking_sequences | AAAATCGAAAATTGTTCATTTTCAACTGGA | TTTTGTTCATTCGAATCTGTAAATCAAGTT | |||
Mapping_target | C09B9 | ||||
Type_of_mutation | Substitution | T | G | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00033305 | ||||
Laboratory | RB | ||||
Person | WBPerson46 | ||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00020906 | |||
Transcript | T28H11.8.1 | VEP_consequence | 5_prime_UTR_variant | ||
VEP_impact | MODIFIER | ||||
HGVSc | T28H11.8.1:c.-12A>C | ||||
cDNA_position | 17 | ||||
Exon_number | 1/9 | ||||
Isolation | Mutagen | ENU | |||
Reference | WBPaper00036200 | ||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |