WormBase Tree Display for Variation: WBVar00277413
expand all nodes | collapse all nodes | view schema
WBVar00277413 | Evidence | Paper_evidence | WBPaper00036200 | ||
---|---|---|---|---|---|
Name | Public_name | gk2828 | |||
Other_name | W02B12.8a.1:c.1007T>G | ||||
CE03768:p.Leu336Arg | |||||
CE38231:p.Leu137Arg | |||||
W02B12.8b.1:c.410T>G | |||||
HGVSg | CHROMOSOME_II:g.11468119T>G | ||||
Sequence_details | SMap | S_parent | Sequence | W02B12 | |
Flanking_sequences | CTGTACTTTTGAAGACGTTCTTCAGGAGCC | CGGAGAGCCCCTAACGACCAATAGGCTTTA | |||
Mapping_target | W02B12 | ||||
Type_of_mutation | Substitution | T | G | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00005866 | ||||
Laboratory | VC | ||||
Person | WBPerson427 | ||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00012203 | |||
Transcript | W02B12.8a.1 (12) | ||||
W02B12.8b.1 (12) | |||||
Isolation | Mutagen | EMS | |||
Reference | WBPaper00036200 | ||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |