WormBase Tree Display for Variation: WBVar00277415
expand all nodes | collapse all nodes | view schema
WBVar00277415 | Evidence | Paper_evidence | WBPaper00036200 | ||
---|---|---|---|---|---|
Name | Public_name | ok5025 | |||
Other_name | W02B9.1a.1:c.461+257G>A | ||||
W02B9.1b.1:c.5414+561G>A | |||||
W02B9.1a.2:c.461+257G>A | |||||
HGVSg | CHROMOSOME_I:g.11093542C>T | ||||
Sequence_details | SMap | S_parent | Sequence | W02B9 | |
Flanking_sequences | ACTTTTTCACGCAAAAGGTGTCAGAATGCC | CATGTCGGTTTGATCTACGAGAATAGCGGG | |||
Mapping_target | W02B9 | ||||
Type_of_mutation | Substitution | C | T | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00033304 | ||||
Laboratory | RB | ||||
Person | WBPerson46 | ||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00001980 | |||
Transcript | W02B9.1a.2 | VEP_consequence | intron_variant | ||
VEP_impact | MODIFIER | ||||
HGVSc | W02B9.1a.2:c.461+257G>A | ||||
Intron_number | 3/12 | ||||
W02B9.1b.1 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | W02B9.1b.1:c.5414+561G>A | ||||
Intron_number | 23/32 | ||||
W02B9.1a.1 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | W02B9.1a.1:c.461+257G>A | ||||
Intron_number | 2/11 | ||||
Isolation | Mutagen | EMS | |||
Reference | WBPaper00036200 | ||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |