WormBase Tree Display for Variation: WBVar00277421
expand all nodes | collapse all nodes | view schema
WBVar00277421 | Evidence | Paper_evidence | WBPaper00036200 | ||
---|---|---|---|---|---|
Name | Public_name | gk2630 | |||
Other_name | W02G9.5b.1:c.1235+198G>C | ||||
W02G9.5a.1:c.1433+198G>C | |||||
W02G9.5c.1:c.818+198G>C | |||||
HGVSg | CHROMOSOME_V:g.2660965G>C | ||||
Sequence_details | SMap | S_parent | Sequence | W02G9 | |
Flanking_sequences | TCGGAAAATTGCCGGAATTTAAAATTTCCG | CAAATCGCCAAATTGCCGGAATTAAAAAGT | |||
Mapping_target | W02G9 | ||||
Type_of_mutation | Substitution | G | C | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00037340 | ||||
Laboratory | VC | ||||
Person | WBPerson427 | ||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00020955 | |||
Transcript | W02G9.5a.1 | VEP_consequence | intron_variant | ||
VEP_impact | MODIFIER | ||||
HGVSc | W02G9.5a.1:c.1433+198G>C | ||||
Intron_number | 7/7 | ||||
W02G9.5c.1 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | W02G9.5c.1:c.818+198G>C | ||||
Intron_number | 3/3 | ||||
W02G9.5b.1 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | W02G9.5b.1:c.1235+198G>C | ||||
Intron_number | 6/6 | ||||
Isolation | Mutagen | ENU | |||
Reference | WBPaper00036200 | ||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |