WormBase Tree Display for Variation: WBVar00277494

WBVar00277494 Evidence: Paper_evidence: WBPaper00036200
  Name: Public_name: ok5729
    Other_name: Y105C5B.16a.1:c.413+765C>T
    HGVSg: CHROMOSOME_IV:g.15960864G>A
  Sequence_details: SMap: S_parent: Sequence: Y105C5B
    Flanking_sequences: CGGCCTTCATTGCAAGTTCTTACTTAAATT CATTTTTTACTGTTTCAACTTGGTGAGAAG
    Mapping_target: Y105C5B
    Type_of_mutation: Substitution: G A
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00033306
    Laboratory: RB
    Person: WBPerson46
    Analysis: Million_Mutation_Pilot_Project
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00013655
    Transcript: Y105C5B.16a.1 VEP_consequence: intron_variant
        VEP_impact: MODIFIER
        HGVSc: Y105C5B.16a.1:c.413+765C>T
        Intron_number: 4/7
  Isolation: Mutagen: EMS
  Reference: WBPaper00036200
  Remark: Allele identified through whole-genome sequencing by the Gene Knockout Consortium Paper_evidence: WBPaper00036200
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele