WormBase Tree Display for Variation: WBVar00277542

WBVar00277542 Evidence: Paper_evidence: WBPaper00036200
  Name: Public_name: gk2036
    Other_name: Y113G7A.12.1:c.*31C>T
    HGVSg: CHROMOSOME_V:g.20146357C>T
  Sequence_details: SMap: S_parent: Sequence: Y113G7A
    Flanking_sequences: AACACTCGTTCGAATGTGAGGAAATAGCGG GGAGTCGCTTCTGCAATAGCGATTGAAGCA
    Mapping_target: Y113G7A
    Type_of_mutation: Substitution: C T
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00036970
    Laboratory: VC
    Person: WBPerson427
    Analysis: Million_Mutation_Pilot_Project
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00013749
    Transcript: Y113G7A.12.1 VEP_consequence: 3_prime_UTR_variant
        VEP_impact: MODIFIER
        HGVSc: Y113G7A.12.1:c.*31C>T
        cDNA_position: 675
        Exon_number: 8/10
  Isolation: Mutagen: EMS
  Reference: WBPaper00036200
  Remark: Allele identified through whole-genome sequencing by the Gene Knockout Consortium Paper_evidence: WBPaper00036200
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele